NEET (UG)-2024 Biology Solution

Ad Code

Responsive Advertisement

NEET (UG)-2024 Biology Solution

Q1. Match List I with List II

List-I List-II

A. Rhizopus I. Mushroom

B. Ustilago II. Smut fungus

C. Puccinia III. Bread mould

D. Agaricus IV. Rust fungus

Choose the correct answer from the options given below:


(1) A-III, B-II, C-IV, D-I

(2) A-I, B-III, C-II, D-IV

(3) A-III, B-II, C-I, D-IV

(4) A-IV, B-III, C-II, D-I

Answer (1)


Q2. Identify the part of the seed from the given figure which is destined to form root when the seed germinates.

(1) A

(2) B

(3) C

(4) D

Answer (3)


Q3. Lecithin, a small molecular weight organic compound found in living tissues, is an example of:

(1) Amino acids

(2) Phospholipids

(3) Glycerides

(4) Carbohydrates

Answer (2)


Q4. A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and downstream end;

(1) Repressor, Operator gene, Structural gene

(2) Structural gene, Transposons, Operator gene

(3) Inducer, Repressor, Structural gene

(4) Promotor, Structural gene, Terminator

Answer (4)


Q5. Auxin is used by gardeners to prepare weed-free lawns. But no damage is caused to grass as auxin

(1) promotes apical dominance.

(2) promotes abscission of mature leaves only.

(3) does not affect mature monocotyledonous plants.

(4) can help in cell division in grasses, to produce growth.

Answer (3)


Q7. These are regarded as major causes of biodiversity loss:

A. Over exploitation

B. Co-extinction

C. Mutation

D. Habitat loss and fragmentation

E. Migration

Choose the correct option:

(1) A, C and D only

(2) A, B, C and D only

(3) A, B and E only

(4) A, B and D only

Answer (4)


Q8. Match List I with List II

List I List II

A. Clostridium butylicum I. Ethanol

B. Saccharomyces cerevisiae II. Streptokinase

C. Trichoderma polysporum III. Butyric acid

D. Streptococcus sp. IV. Cyclosporin-A

Choose the correct answer from the options given below:

(1) A-III, B-I, C-II, D-IV

(2) A-II, B-IV, C-III, D-I

(3) A-III, B-I, C-IV, D-II

(4) A-IV, B-I, C-III, D-II

Answer (3)


Q9. Spindle fibers attach to kinetochores of chromosomes during

(1) Prophase 

(2) Metaphase

(3) Anaphase 

(4) Telophase

Answer (2)


Q10. Which of the following is an example of actinomorphic flower?

(1) Datura 

(2) Cassia

(3) Pisum 

(4) Sesbania

Answer (1)


Q11. The cofactor of the enzyme carboxypeptidase is:

(1) Zinc 

(2) Niacin

(3) Flavin 

(4) Haem

Answer (1)


Q12. Match List I with List II

List-I List-II

A. Nucleolus I. Site of formation of glycolipid

B. Centriole II. Organization like the cartwheel

C. Leucoplasts III. Site for active ribosomal RNA synthesis

D. Golgi apparatus IV. For storing nutrients

Choose the correct answer from the options given below:

(1) A-III, B-II, C-IV, D-I

(2) A-II, B-III, C-I, D-IV

(3) A-III, B-IV, C-II, D-I

(4) A-I, B-II, C-III, D-IV

Answer (1)


Q13. The capacity to generate a whole plant from any cell of the plant is called:

(1) Totipotency

(2) Micropropagation

(3) Differentiation

(4) Somatic hybridization

Answer (1)


Q14. Hind II always cuts DNA molecules at a particular point called recognition sequence and it consists of:

(1) 8 bp

(2) 6 bp

(3) 4 bp

(4) 10 bp

Answer (2)


Q15. Identify the set of correct statements:

A. The flowers of Vallisneria are colourful and produce nectar.

B. The flowers of water lily are not pollinated by water.

C. In most of water-pollinated species, the pollen grains are protected from wetting.

D. Pollen grains of some hydrophytes are long and ribbon like.

E. In some hydrophytes, the pollen grains are carried passively inside water.

Choose the correct answer from the options given below.

(1) C, D and E only

(2) A, B, C and D only

(3) A, C, D and E only

(4) B, C, D and E only

Answer (4)


Q16. Given below are two statements:

Statement I: Parenchyma is living but collenchyma is dead tissue.

Statement II: Gymnosperms lack xylem vessels but presence of xylem vessels is the characteristic of angiosperms.

In the light of the above statements, choose the correct answer from the options given below:

(1) Both Statement I and Statement II are true

(2) Both Statement I and Statement II are false

(3) Statement I is true but Statement II is false

(4) Statement I is false but Statement II is true

Answer (4)


Q17. Formation of interfascicular cambium from fully developed parenchyma cells is an example for

(1) Differentiation

(2) Redifferentiation

(3) Dedifferentiation

(4) Maturation

Answer (3)


Q18. Inhibition of Succinic dehydrogenase enzyme by malonate is a classical example of:

(1) Cofactor inhibition

(2) Feedback inhibition

(3) Competitive inhibition

(4) Enzyme activation

Answer (3)


Q19. In a plant, black seed color (BB/Bb) is dominant over white seed color (bb). In order to find out the genotype of the black seed plant, with which of the following genotype will you cross it?

(1) BB

(2) bb

(3) Bb

(4) BB/Bb

Answer (2)


Q20. Tropical regions show the greatest level of species richness because:

A. Tropical latitudes have remained relatively undisturbed for millions of years, hence more time was available for species diversification.

B. Tropical environments are more seasonal.

C. More solar energy is available in the tropics.

D. Constant environments promote niche specialization.

E. Tropical environments are constant and predictable.

Choose the correct answer from the options given below:

(1) A, C, D and E only

(2) A and B only

(3) A, B and E only

(4) A, B and D only

Answer (1)


Q21. In the given figure, which component has thin outer walls and highly thickened inner walls?

(1) C

(2) D

(3) A

(4) B

Answer (1)


Q22. Given below are two statements:

Statement I: Chromosomes become gradually visible under a light microscope during the leptotene stage.

Statement II: The beginning of the diplotene stage is recognized by the dissolution of the synaptonemal complex.

In the light of the above statements, choose the correct answer from the options given below:

(1) Both Statement I and Statement II are true

(2) Both Statement I and Statement II are false

(3) Statement I is true but Statement II is false

(4) Statement I is false but Statement II is true

Answer (1)


Q23. The list of endangered species was released by:

(1) GEAC

(2) WWF

(3) FOAM

(4) IUCN

Answer (4)


Q24. The type of conservation in which the threatened species are taken out from their natural habitat and placed in special settings where they can be protected and given special care is called:

(1) In-situ conservation

(2) Biodiversity conservation

(3) Semi-conservative method

(4) Sustainable development

Answer (2)


Q25. What is the fate of a piece of DNA carrying only the gene of interest which is transferred into an alien organism?

A. The piece of DNA would be able to multiply itself independently in the progeny cells of the organism.

B. It may get integrated into the genome of the recipient.

C. It may multiply and be inherited along with the host DNA.

D. The alien piece of DNA is not an integral part of the chromosome.

E. It shows the ability to replicate.

Choose the correct answer from the options given below:

(1) A and B only

(2) D and E only

(3) B and C only

(4) A and E only

Answer (3)


Q26. The lactose present in the growth medium of bacteria is transported to the cell by the action of:

(1) Beta-galactosidase

(2) Acetylase

(3) Permease

(4) Polymerase

Answer (3)


Q28. Which one of the following is not a criterion for the classification of fungi?

(1) Morphology of mycelium

(2) Mode of nutrition

(3) Mode of spore formation

(4) Fruiting body

Answer (2)


Q29. Given below are two statements:

Statement I: Bt toxins are insect group-specific and coded by a gene cry IAc.

Statement II: Bt toxin exists as an inactive protoxin in B. thuringiensis. However, after ingestion by the insect, the inactive protoxin gets converted into an active form due to the acidic pH of the insect gut.

In the light of the above statements, choose the correct answer from the options given below:

(1) Both Statement I and Statement II are true

(2) Both Statement I and Statement II are false

(3) Statement I is true but Statement II is false

(4) Statement I is false but Statement II is true

Answer (3)


Q30. Bulliform cells are responsible for:

(1) Inward curling of leaves in monocots.

(2) Protecting the plant from salt stress.

(3) Increased photosynthesis in monocots.

(4) Providing large spaces for the storage of sugars.

Answer (1)


Q31. A pink-flowered Snapdragon plant was crossed with a red-flowered Snapdragon plant. What type of phenotype/s is/are expected in the progeny?

(1) Only red-flowered plants

(2) Red-flowered as well as pink-flowered plants

(3) Only pink-flowered plants

(4) Red, Pink as well as white-flowered plants

Answer (2)


Q32. How many molecules of ATP and NADPH are required for every molecule of CO2 fixed in the Calvin cycle?

(1) 2 molecules of ATP and 3 molecules of NADPH

(2) 2 molecules of ATP and 2 molecules of NADPH

(3) 3 molecules of ATP and 3 molecules of NADPH

(4) 3 molecules of ATP and 2 molecules of NADPH

Answer (4)


Q33. Match List I with List II

List I List II

A. Robert May I. Species-Area relationship

B. Alexander von Humboldt II. Long-term ecosystem experiment using outdoor plots

C. Paul Ehrlich III. Global species diversity at about 7 million

D. David Tilman IV. Rivet popper hypothesis

Choose the correct answer from the options given below:

(1) A-II, B-III, C-I, D-IV

(2) A-III, B-I, C-IV, D-II

(3) A-I, B-III, C-II, D-IV

(4) A-III, B-IV, C-II, D-I

Answer (2)


Q31. Identify the correct description about the given figure:

(1) Wind-pollinated plant inflorescence showing flowers with well-exposed stamens.

(2) Water-pollinated flowers showing stamens with a mucilaginous covering.

(3) Cleistogamous flowers showing autogamy.

(4) Compact inflorescence showing complete autogamy.

Answer (1)


Q32. Match List I with List II

List I List II

A. Frederick Griffith I. Genetic code

B. Francois Jacob & Jacque Monod II. Semi-conservative mode of DNA replication

C. Har Gobind Khorana III. Transformation

D. Meselson & Stahl IV. Lac operon

Choose the correct answer from the options given below:

(1) A-III, B-II, C-I, D-IV

(2) A-III, B-IV, C-I, D-II

(3) A-II, B-III, C-IV, D-I

(4) A-IV, B-I, C-II, D-III

Answer (2)


Q33. Spraying sugarcane crop with which of the following plant growth regulators increases the length of the stem, thus increasing the yield?

(1) Auxin

(2) Gibberellin

(3) Cytokinin

(4) Abscisic acid

Answer (2)


Q34. Match List I with List II

List I List II

A. Rose I. Twisted aestivation

B. Pea II. Perigynous flower

C. Cotton III. Drupe

D. Mango IV. Marginal placentation

Choose the correct answer from the options given below:

(1) A-II, B-IV, C-I, D-III

(2) A-I, B-II, C-III, D-IV

(3) A-IV, B-III, C-II, D-I

(4) A-II, B-III, C-IV, D-I

Answer (1)


Q35. Read the following statements and choose the set of correct statements:

In the members of Phaeophyceae,

A. Asexual reproduction occurs usually by biflagellate zoospores.

B. Sexual reproduction is by the oogamous method only.

C. Stored food is in the form of carbohydrates, which is either mannitol or laminarin.

D. The major pigments found are chlorophyll a, c, and carotenoids and xanthophyll.

E. Vegetative cells have a cellulosic wall, usually covered on the outside by a gelatinous coating of algin.

Choose the correct answer from the options given below:

(1) A, B, C and D only

(2) B, C, D and E only

(3) A, C, D and E only

(4) A, B, C and E only

Answer (3)


Q36. Identify the step in the tricarboxylic acid cycle, which does not involve the oxidation of the substrate.

(1) Malic acid → Oxaloacetic acid

(2) Succinic acid → Malic acid

(3) Succinyl-CoA → Succinic acid

(4) Isocitrate → α-ketoglutaric acid

Answer (3)


Q37. Given below are two statements:

Statement I: In C₃ plants, some O₂ binds to RuBiSCO, hence CO₂ fixation is decreased.

Statement II: In C₄ plants, mesophyll cells show very little photorespiration while bundle sheath cells do not show photorespiration.

In the light of the above statements, choose the correct answer from the options given below:

(1) Both Statement I and Statement II are true

(2) Both Statement I and Statement II are false

(3) Statement I is true but Statement II is false

(4) Statement I is false but Statement II is true

Answer (3)


Q38. Match List-I with List-II

List-I List-II

A. GLUT-4 I. Hormone

B. Insulin II. Enzyme

C. Trypsin III. Intercellular ground substance

D. Collagen IV. Enables glucose transport into cells

Choose the correct answer from the options given below:

(1) A-IV, B-I, C-II, D-III

(2) A-I, B-II, C-III, D-IV

(3) A-II, B-III, C-IV, D-I

(4) A-III, B-IV, C-I, D-II

Answer (1)


Q39. Match List I with List II

List I List II

A. Monoadelphous I. Citrus

B. Diadelphous II. Pea

C. Polyadelphous III. Lily

D. Epiphyllous IV. China-rose

Choose the correct answer from the options given below:

(1) A-IV, B-II, C-I, D-III

(2) A-IV, B-I, C-II, D-III

(3) A-I, B-II, C-IV, D-III

(4) A-III, B-I, C-IV, D-II

Answer (1)


Q40. The DNA present in chloroplast is:

(1) Linear, double-stranded

(2) Circular, double-stranded

(3) Linear, single-stranded

(4) Circular, single-stranded

Answer (2)


Q41. Which of the following are fused in somatic hybridization involving two varieties of plants?

(1) Callus

(2) Somatic embryos

(3) Protoplasts

(4) Pollens

Answer (3)


Q42. Match List I with List II

List I List II

A. Citric acid cycle I. Cytoplasm

B. Glycolysis II. Mitochondrial matrix

C. Electron transport system III. Intermembrane space of mitochondria

D. Proton gradient IV. Inner mitochondrial membrane

Choose the correct answer from the options given below:

(1) A-I, B-II, C-III, D-IV

(2) A-II, B-I, C-IV, D-III

(3) A-III, B-IV, C-I, D-II

(4) A-IV, B-III, C-II, D-I

Answer (2)


Q43. Given below are two statements:

Statement I: The presence or absence of the hymen is not a reliable indicator of virginity.

Statement II: The hymen is torn during the first coitus only.

In the light of the above statements, choose the correct answer from the options given below:

(1) Both Statement I and Statement II are true

(2) Both Statement I and Statement II are false

(3) Statement I is true but Statement II is false

(4) Statement I is false but Statement II is true

Answer (3)


Which of the following statements is incorrect?

(1) A bio-reactor provides optimal growth conditions for achieving the desired product.

(2) Most commonly used bio-reactors are of the stirring type.

(3) Bio-reactors are used to produce small-scale bacterial cultures.

(4) Bio-reactors have an agitator system, an oxygen delivery system, and a foam control system.

Answer (3)


Q44. Which one is the correct product of DNA-dependent RNA polymerase to the given template?

3TACATGGCAAATATCCATTCA5'

(1) 5'AUGUACCGUUUAAGGUAAGU3'

(2) 5'AUGUAAAGUUUAUAGGUAAGU3'

(3) 5'AUGUACCGUUUAAGGGAAAGU3'

(4) 5'ATGTACCGTTTATAGGTAAGT3'

Answer (1)


Q45. Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R:

Assertion A: FSH acts upon ovarian follicles in females and Leydig cells in males.

Reason R: Growing ovarian follicles secrete estrogen in females while interstitial cells secrete androgen in male human beings.

In the light of the above statements, choose the correct answer from the options given below:

(1) Both A and R are true and R is the correct explanation of A.

(2) Both A and R are true but R is NOT the correct explanation of A.

(3) A is true but R is false.

(4) A is false but R is true.

Answer (4)


Q46. Match List I with List II

List I List II

A. Typhoid I. Fungus

B. Leishmaniasis II. Nematode

C. Ringworm III. Protozoa

D. Filariasis IV. Bacteria

Choose the correct answer from the options given below:

(1) A-I, B-III, C-II, D-IV

(2) A-IV, B-III, C-I, D-II

(3) A-III, B-I, C-IV, D-II

(4) A-II, B-IV, C-III, D-I

Answer (2)


Q47. Following are the stages of the pathway for the conduction of an action potential through the heart:

A. AV bundle

B. Purkinje fibres

C. AV node

D. Bundle branches

E. SA node

Choose the correct sequence of the pathway from the options given below:

(1) E-C-A-D-B

(2) A-E-C-B-D

(3) B-D-E-C-A

(4) E-A-D-B-C

Answer (1)


Q48. Match List I with List II

List I (Sub Phases of Prophase I) List II (Specific Characters)

A. Diakinesis I. Synaptonemal complex formation

B. Pachytene II. Completion of terminalisation of chiasmata

C. Zygotene III. Chromosomes look like thin threads

D. Leptotene IV. Appearance of recombination nodules

Choose the correct answer from the options given below:

(1) A-IV, B-II, C-III, D-I

(2) A-I, B-II, C-IV, D-III

(3) A-II, B-IV, C-I, D-II

(4) A-IV, B-III, C-II, D-I

Answer (3)


49. Three types of muscles are given as a, b, and c. Identify the correct matching pair along with their location in the human body:

(1) (a) Smooth - Toes

(b) Skeletal – Legs

(c) Cardiac – Heart

(2) (a) Skeletal - Triceps

(b) Smooth – Stomach

(c) Cardiac – Heart

(3) (a) Skeletal - Biceps

(b) Involuntary – Intestine

(c) Smooth – Heart

(4) (a) Involuntary – Nose tip

(b) Skeletal – Bone

(c) Cardiac – Heart

Answer (2)


Q50. Match List I with List II

List I List II

A. Non-medicated IUD I. Multiload 375

B. Copper releasing IUD II. Progestogens

C. Hormone releasing IUD III. Lippes loop

D. Implants IV. LNG-20

Choose the correct answer from the options given below:

(1) A-III, B-I, C-II, D-IV

(2) A-I, B-III, C-IV, D-II

(3) A-IV, B-I, C-II, D-III

(4) A-III, B-I, C-IV, D-II

Answer (4)


Q51. Match List I with List II

List I List II

A. Lipase I. Peptide bond

B. Nuclease II. Ester bond

C. Protease III. Glycosidic bond

D. Amylase IV. Phosphodiester bond

Choose the correct answer from the options given below:

(1) A-IV, B-II, C-III, D-I

(2) A-III, B-II, C-I, D-IV

(3) A-II, B-IV, C-I, D-III

(4) A-IV, B-I, C-III, D-II

Answer (3)


Q52. Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R:

Assertion A: Breast-feeding during the initial period of infant growth is recommended by doctors for bringing a healthy baby.

Reason R: Colostrum contains several antibodies absolutely essential to develop resistance for the newborn baby.

In the light of the above statements, choose the most appropriate answer from the options given below:

(1) Both A and R are correct and R is the correct explanation of A.

(2) Both A and R are correct but R is NOT the correct explanation of A.

(3) A is correct but R is not correct.

(4) A is not correct but R is correct.

Answer (1)


Q53. Given below are some stages of human evolution. Arrange them in the correct sequence (Past to Recent):

A. Homo habilis

B. Homo sapiens

C. Homo neanderthalensis

D. Homo erectus

Choose the correct sequence of human evolution from the options given below:

(1) D-A-C-B

(2) B-A-D-C

(3) C-B-D-A

(4) A-D-C-B

Answer (4)


54. Match List I with List II

List I List II

A. Axoneme I. Centriole

B. Cartwheel pattern II. Cilia and flagella

C. Crista III. Chromosome

D. Satellite IV. Mitochondria

Choose the correct answer from the options given below:

(1) A-IV, B-III, C-II, D-I

(2) A-IV, B-II, C-III, D-I

(3) A-II, B-IV, C-I, D-III

(4) A-II, B-I, C-IV, D-III

Answer (4)


55. Match List I with List II

List I List II

A. Petrophyllum I. Hag fish

B. Myxine II. Saw fish

C. Pristis III. Angel fish

D. Exocoetus IV. Flying fish

Choose the correct answer from the options given below:

(1) A-II, B-I, C-III, D-IV

(2) A-III, B-I, C-II, D-IV

(3) A-IV, B-I, C-II, D-III

(4) A-III, B-II, C-I, D-IV

Answer (2)


Q56. Match List I with List II

List I List II

A. α–I antitrypsin I. Cotton bollworm

B. Cry IAb II. ADA deficiency

C. Cry IAc III. Emphysema

D. Enzyme replacement therapy IV. Corn borer

Choose the correct answer from the options given below:

(1) A-II, B-I, C-IV, D-III

(2) A-III, B-I, C-II, D-IV

(3) A-III, B-IV, C-I, D-II

(4) A-II, B-IV, C-I, D-III

Answer (3)


Q57. The "Ti plasmid" of Agrobacterium tumefaciens stands for:

(1) Tumour inhibiting plasmid

(2) Tumor independent plasmid

(3) Tumor inducing plasmid

(4) Temperature independent plasmid

Answer (3)


Q58. Match List I with List II

List I List II

A. Pleurobrachia I. Mollusca

B. Radula II. Ctenophora

C. Stomochord III. Osteichthyes

D. Air bladder IV. Hemichordata

Choose the correct answer from the options given below:

(1) A-IV, B-II, C-III, D-I

(2) A-II, B-I, C-IV, D-III

(3) A-II, B-IV, C-I, D-III

(4) A-IV, B-III, C-II, D-I

Answer (2)


Q59. Which of the following is not a natural/traditional contraceptive method?

(1) Coitus interruptus

(2) Periodic abstinence

(3) Lactational amenorrhea

(4) Vaults

Answer (4)


Q60. Following are the stages of cell division:

A. Gap 2 phase

B. Cytokinesis

C. Synthesis phase

D. Karyokinesis

E. Gap 1 phase

Choose the correct sequence of stages from the options given below:

(1) C-E-D-A-B

(2) E-B-D-A-C

(3) B-D-E-A-C

(4) E-C-A-D-B

Answer (4)


Q61. Which one of the following factors will not affect the Hardy-Weinberg equilibrium?

(1) Genetic recombination

(2) Genetic drift

(3) Gene migration

(4) Constant gene pool

Answer (4)


Q62. Match List I with List II

List I List II

A. Pons I. Provides additional space for Neurons, regulates posture and balance.

B. Hypothalamus II. Controls respiration and gastric secretions.

C. Medulla III. Connects different regions of the brain.

D. Cerebellum IV. Neurosecretory cells

Choose the correct answer from the options given below:

(1) A-II, B-III, C-I, D-IV

(2) A-III, B-IV, C-II, D-I

(3) A-I, B-III, C-II, D-IV

(4) A-II, B-I, C-III, D-IV

Answer (2)




Post a Comment

0 Comments